SecReT6
Protein ID: 126463883
SecReT6 ID177
T6SS typei3
Gene symbol-
Locus tagRsph17029_3124
StrainRhodobacter sphaeroides ATCC 17029
Repliconchromosome II [GenBank: NC_009050] [Browse all T6SS(s) in this replicon]
Location [Strand]139847..140554 [+]
ProductGPW/gp25 family protein
NoteTssE
UniProt IDA3PPF8
KEGG IDrsh:Rsph17029_3124
PDB IDNA
Domain hit(s) vs Pfam GPW_gp25 [PF04965], Evalue: 2.40E-26, Aligned region: 92..215
Protein Sequence: 235 a.a.     [Download]
>gi|126463883|ref|YP_001044996.1| GPW/gp25 family protein [Rhodobacter sphaeroides ATCC 17029]
MPETVIPPHARREAVQPSLWDRLREDLPGLIAESGRARAALARELGEERLDELLGRGRAGLAGLDEGQRR
AVLRLMALLDRRAFLEEHGLLVTPEALREAVRRDVEALFNTERLQAHLLLGAAERGAAEDPADTLEDFPH
VRRSVLNFGVPAFSGRRARDFDPERLARDLREVVALFEPRLRRDTLRIRVDTHDRSGLRISIEGVLMLAP
VPERLRLSTMLDLDTGSASTALEEA
 
Nucleotide Sequence: 708 bp     [Download]
>gi|126463752|ref|NC_009050.1|:139847-140554 Rhodobacter sphaeroides ATCC 17029 chromosome 2, complete sequence
ATGCCCGAGACGGTGATACCCCCTCATGCCCGCCGCGAGGCGGTGCAGCCGAGCCTCTGGGACCGGCTGC
GCGAGGATCTGCCCGGTCTCATCGCCGAAAGCGGGCGGGCCCGGGCGGCCCTCGCGCGCGAACTGGGCGA
GGAGCGGCTGGACGAGCTGCTCGGCCGGGGGCGGGCGGGGCTGGCCGGTCTCGACGAGGGGCAGCGCCGC
GCCGTCCTGCGGCTGATGGCGCTGCTCGACCGGCGCGCGTTTCTCGAGGAGCACGGCCTTCTCGTGACCC
CCGAGGCGCTGCGCGAGGCCGTCCGACGCGATGTCGAGGCGCTTTTCAACACCGAGCGGCTGCAGGCCCA
TCTTCTGCTCGGCGCAGCCGAGCGCGGGGCGGCGGAAGACCCCGCCGATACTCTCGAAGACTTCCCCCAT
GTCCGGCGCAGCGTGCTGAACTTCGGCGTTCCCGCCTTTTCGGGCCGGCGCGCGCGCGACTTCGATCCCG
AGCGGCTGGCGCGCGATCTGCGCGAGGTGGTGGCTTTGTTCGAGCCGCGGCTGCGGCGCGACACGCTCAG
GATCCGGGTGGACACCCACGACCGCAGCGGCCTGCGCATCTCCATCGAGGGGGTGCTGATGCTCGCCCCC
GTGCCCGAGCGGTTGCGGCTGTCAACCATGCTCGACCTCGACACCGGCAGCGCCTCGACCGCGCTCGAGG
AGGCGTGA