SecReT6
Protein ID: 220922981
SecReT6 ID327
T6SS typei3
Gene symbol-
Locus tagMnod_3039
StrainMethylobacterium nodulans ORS 2060
Repliconchromosome [GenBank: NC_011894] [Browse all T6SS(s) in this replicon]
Location [Strand]3131883..3132434 [-]
Producttype VI secretion system lysozyme-like protein
NoteTssE
UniProt IDB8IIB1
KEGG IDmno:Mnod_3039
PDB IDNA
Domain hit(s) vs Pfam GPW_gp25 [PF04965], Evalue: 5.10E-17, Aligned region: 55..161
Protein Sequence: 183 a.a.     [Download]
>gi|220922981|ref|YP_002498283.1| type VI secretion system lysozyme-like protein [Methylobacterium nodulans ORS 2060]
MSSLLRERRVRASLISAFRTAHAAHDARKPAPAREAGGERVVAGRRSAARAAIPEAELRRAVAGDVETLM
NTIRLGASLDLAAHPHVARSVLNYGLPDLVHRSIDEGAVRGLAEEIRATLEAHEPRLVPGSIRVARDPAA
SAAALKLRFLITAALDAEPLNLPVEFVADLERDTGKIVLGRRS
 
Nucleotide Sequence: 552 bp     [Download]
>gi|220920054|ref|NC_011894.1|:c3132434-3131883 Methylobacterium nodulans ORS 2060 chromosome, complete genome
ATGTCGTCCCTGCTGCGCGAACGGCGCGTGCGCGCCTCCCTGATATCGGCCTTCCGGACGGCCCATGCTG
CGCACGACGCGCGCAAACCCGCGCCCGCGCGCGAGGCCGGCGGCGAGCGCGTGGTGGCCGGGCGCCGGAG
CGCGGCCCGCGCGGCGATTCCCGAAGCCGAGCTGCGCCGGGCGGTCGCGGGCGACGTCGAGACCCTGATG
AACACGATCCGCCTCGGGGCGAGCCTCGACCTCGCGGCGCATCCGCACGTCGCCCGCTCGGTCCTCAATT
ACGGCCTGCCCGACCTCGTCCACCGCTCCATCGACGAGGGGGCGGTGCGCGGCCTCGCCGAGGAGATCCG
CGCGACGCTGGAAGCCCACGAGCCGCGCCTCGTCCCGGGCTCGATCCGGGTGGCGCGCGACCCCGCGGCG
AGCGCCGCCGCGCTCAAGCTGCGCTTCCTCATCACCGCGGCGCTCGACGCCGAACCCCTCAACCTGCCGG
TCGAGTTCGTAGCCGACCTCGAACGCGACACCGGCAAGATCGTGCTCGGGCGGCGGTCATGA