SecReT6
Protein ID: 221369482
SecReT6 ID328
T6SS typei3
Gene symbol-
Locus tagRSKD131_3645
StrainRhodobacter sphaeroides KD131
Repliconchromosome II [GenBank: NC_011958] [Browse all T6SS(s) in this replicon]
Location [Strand]567227..567934 [+]
Producthypothetical protein
NoteTssE
UniProt IDB9KTX7
KEGG IDrsk:RSKD131_3645
PDB IDNA
Domain hit(s) vs Pfam GPW_gp25 [PF04965], Evalue: 2.50E-26, Aligned region: 92..215
Protein Sequence: 235 a.a.     [Download]
>gi|221369482|ref|YP_002520578.1| hypothetical protein RSKD131_3645 [Rhodobacter sphaeroides KD131]
MPETVIPPHARREAVQPSLWDRLREDLPGLIAESGRARAALARELGEERLDELLARGRSGLTGLDKGQRR
AVLRLMALLDRRAFLEEHGLLVTPEALREAVRRDVEALFNTERLQAHLLLGTAERGAAEDPADTLENFPH
VRRSVLNFGVPAFSGRRARDFDPERLARDLREVVALFEPRLRRDTLRIRVDTHDRSGLRISIEGVLMLAP
VPERLRLSTMLDLDTGSASTALEEA
 
Nucleotide Sequence: 708 bp     [Download]
>gi|221368938|ref|NC_011958.1|:567227-567934 Rhodobacter sphaeroides KD131 chromosome 2, complete sequence
ATGCCCGAGACGGTGATACCCCCTCATGCCCGCCGCGAGGCGGTGCAGCCGAGCCTCTGGGACCGGCTGC
GCGAGGATCTGCCCGGCCTCATCGCCGAAAGCGGGCGGGCCCGGGCGGCCCTCGCGCGCGAACTGGGCGA
AGAGCGGCTGGACGAGCTGCTCGCCCGGGGGCGGTCGGGGCTGACCGGTCTCGACAAGGGGCAGCGGCGC
GCCGTCCTGCGGCTGATGGCGCTGCTCGACCGGCGCGCGTTTCTCGAGGAGCACGGCCTTCTCGTGACCC
CCGAGGCGCTGCGCGAGGCCGTCCGACGCGACGTCGAGGCGCTCTTCAACACCGAGCGGCTGCAGGCCCA
TCTTCTGCTCGGCACAGCCGAGCGCGGGGCGGCGGAAGACCCCGCCGATACTCTCGAAAACTTCCCCCAT
GTCCGGCGCAGCGTGCTGAACTTCGGCGTTCCCGCCTTTTCGGGCCGGCGCGCGCGCGACTTCGACCCCG
AGCGGCTGGCGCGCGATCTGCGCGAGGTGGTGGCTTTGTTCGAGCCGCGGCTGCGGCGCGACACGCTCAG
GATCCGCGTGGACACCCACGACCGCAGCGGCCTGCGCATCTCCATCGAGGGGGTGCTGATGCTCGCCCCC
GTGCCCGAGCGGTTGCGGCTGTCAACTATGCTCGACCTCGACACCGGCAGCGCCTCGACCGCGCTCGAGG
AGGCATGA