SecReT6
Protein ID: 226229287
SecReT6 ID332
T6SS typei4b
Gene symbol-
Locus tagGAU_3881
StrainGemmatimonas aurantiaca T-27
Repliconchromosome [GenBank: NC_012489] [Browse all T6SS(s) in this replicon]
Location [Strand]4577665..4577964 [+]
Producthypothetical protein
NotePAAR
UniProt IDC1AEJ6
KEGG IDgau:GAU_3881
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 6.00E-17, Aligned region: 3..19
PAAR_motif [PF05488], Evalue: 6.00E-17, Aligned region: 23..89
DUF4150 [PF13665], Evalue: 0.0017, Aligned region: 12..52
DUF4150 [PF13665], Evalue: 0.0017, Aligned region: 58..84
Protein Sequence: 99 a.a.     [Download]
>gi|226229287|ref|YP_002763393.1| hypothetical protein GAU_3881 [Gemmatimonas aurantiaca T-27]
MPPASRITDMHVCPMMTPGVPPIPHVGGPIVVPGAPTVLIAMLPAATLGSMCVCVGPPSSVIKGSATVLM
GSKPAARMGDNTAHGGVIVLGAPTVMVGG
 
Nucleotide Sequence: 300 bp     [Download]
>ref|NC_012489.1|:4577665-4577964 hypothetical protein GAU_3881 [Gemmatimonas aurantiaca T-27]
ATGCCTCCAGCGTCACGCATCACGGACATGCATGTCTGTCCGATGATGACCCCCGGCGTTCCACCCATTC
CGCATGTCGGCGGGCCGATCGTGGTGCCCGGCGCACCAACGGTGCTGATCGCCATGCTGCCCGCTGCCAC
ACTCGGCAGTATGTGTGTGTGCGTCGGACCGCCGTCGTCCGTCATCAAAGGATCGGCCACGGTGCTCATG
GGCAGCAAGCCGGCCGCACGCATGGGCGACAATACGGCACACGGGGGCGTCATTGTCCTCGGCGCACCCA
CGGTGATGGTGGGCGGCTGA