SecReT6
Protein ID: 253989754
SecReT6 ID356
T6SS typei4b
Gene symbol-
Locus tagPAU_02274
StrainPhotorhabdus asymbiotica subsp. asymbiotica ATCC 43949
Repliconchromosome [GenBank: NC_012962] [Browse all T6SS(s) in this replicon]
Location [Strand]2578265..2578567 [-]
Producthypothetical protein
NotePAAR
UniProt IDB6VKX9
KEGG IDpay:PAU_02274
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 7.50E-21, Aligned region: 2..18
PAAR_motif [PF05488], Evalue: 7.50E-21, Aligned region: 25..93
DUF4150 [PF13665], Evalue: 7.80E-07, Aligned region: 14..53
DUF4150 [PF13665], Evalue: 7.80E-07, Aligned region: 60..91
Protein Sequence: 100 a.a.     [Download]
>gi|253989754|ref|YP_003041110.1| hypothetical protein PAU_02274 [Photorhabdus asymbiotica subsp. asymbiotica ATCC 43949]
MMPMPAARVGDMHICPMVSPAVPPVPHVGGPIMPPGVPTVLIGGLPAATMGSLLVCVGPPDTVVMGSPTV
LIGGRPAARLGDLCAHGGTITTGYPLVIIA
 
Nucleotide Sequence: 303 bp     [Download]
>gi|253987483|ref|NC_012962.1|:c2578567-2578265 Photorhabdus asymbiotica subsp. asymbiotica ATCC 43949 chromosome, complete genome
ATGATGCCAATGCCAGCTGCTCGGGTCGGAGATATGCATATTTGTCCAATGGTATCGCCTGCAGTACCTC
CGGTGCCACATGTGGGTGGGCCTATTATGCCGCCAGGAGTGCCAACGGTTCTTATTGGTGGTTTGCCCGC
GGCGACGATGGGGTCGTTGTTGGTGTGTGTTGGGCCACCGGATACGGTGGTAATGGGAAGTCCAACAGTG
TTAATTGGCGGGCGGCCTGCGGCCAGACTTGGCGATTTGTGCGCCCATGGCGGCACGATCACGACAGGCT
ATCCGTTGGTGATTATTGCCTGA