SecReT6
Protein ID: 397657652
SecReT6 ID677
T6SS typei2
Gene symbol-
Locus tagA225_2639
StrainKlebsiella oxytoca E718
Repliconchromosome [GenBank: NC_018106] [Browse all T6SS(s) in this replicon]
Location [Strand]2790074..2790352 [+]
Producthypothetical protein
NotePAAR
UniProt IDI6VUQ4
KEGG IDkoe:A225_2639
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 2.10E-12, Aligned region: 10..70
Protein Sequence: 92 a.a.     [Download]
>gi|397657652|ref|YP_006498354.1| hypothetical protein A225_2639 [Klebsiella oxytoca E718]
MGAGNYLVVGDKTTCGGVITEGDATQTILGKAAAREGDKVTCGRHSGIYYIAGGMANDMVNGRKMAGTQD
SHSTCPCQARFIPSMMNDNYES
 
Nucleotide Sequence: 279 bp     [Download]
>gi|397655102|ref|NC_018106.1|:2790074-2790352 Klebsiella oxytoca E718 chromosome, complete genome
ATGGGGGCGGGTAACTATTTAGTGGTGGGAGATAAAACCACCTGTGGCGGGGTGATTACTGAAGGTGATG
CCACGCAGACGATACTGGGTAAAGCGGCGGCACGCGAGGGAGATAAAGTGACCTGCGGCAGACATTCCGG
CATTTACTACATCGCAGGTGGTATGGCGAATGACATGGTGAACGGGCGAAAAATGGCGGGAACGCAGGAT
AGTCACAGTACCTGCCCGTGCCAGGCGAGGTTTATCCCTTCCATGATGAATGACAATTACGAAAGTTGA