SecReT6
Protein ID: 398352709
SecReT6 ID669
T6SS typei3
Gene symbol-
Locus tagUSDA257_c28450
StrainSinorhizobium fredii USDA 257
Repliconchromosome [GenBank: NC_018000] [Browse all T6SS(s) in this replicon]
Location [Strand]2984015..2984440 [+]
Producthypothetical protein
NoteTssI
UniProt IDI3X6B0
KEGG IDsfd:USDA257_c28450
PDB IDNA
Domain hit(s) vs Pfam Phage_base_V [PF04717], Evalue: 2.70E-05, Aligned region: 15..39
Phage_base_V [PF04717], Evalue: 2.70E-05, Aligned region: 50..79
Phage_base_V [PF04717], Evalue: 2.70E-05, Aligned region: 89..94
Protein Sequence: 141 a.a.     [Download]
>gi|398352709|ref|YP_006398173.1| hypothetical protein USDA257_c28450 [Sinorhizobium fredii USDA 257]
MSDTRERIEGVVIGVLLGFEAGAPLVVFPGNPRETAMPARSLADLTSVMIGAEVALLFEGGDPTRPLIVG
RIVEPARKPSMPNVVRDGERVRITGEERIELRCGKATIIMEKDGHITIRGTYVTSHASAANRIRGGSVNL
N
 
Nucleotide Sequence: 426 bp     [Download]
>gi|398349897|ref|NC_018000.1|:2984015-2984440 Sinorhizobium fredii USDA 257 chromosome, complete genome
ATGTCCGACACTCGGGAACGTATTGAAGGAGTGGTGATCGGTGTTTTGCTGGGGTTCGAGGCAGGCGCGC
CGCTGGTGGTCTTTCCAGGCAATCCCCGGGAGACCGCGATGCCTGCGCGCAGTCTGGCCGACCTGACGTC
TGTGATGATCGGTGCCGAGGTCGCGTTGCTCTTTGAAGGCGGAGATCCGACGCGGCCGCTCATCGTTGGC
CGAATTGTTGAACCGGCGCGCAAGCCTTCGATGCCGAATGTCGTTCGTGACGGCGAGCGCGTGCGGATCA
CCGGCGAGGAACGCATTGAGCTTCGCTGCGGCAAGGCGACGATCATTATGGAAAAGGATGGTCATATCAC
CATCCGCGGCACCTATGTGACCAGCCACGCCAGCGCCGCGAACCGCATACGTGGCGGATCGGTGAACCTC
AACTGA