SecReT6
Protein ID: 422938863
SecReT6 ID781
T6SS typeii
Gene symbol-
Locus tagFTS_1138
StrainFrancisella tularensis subsp. holarctica FSC200
Repliconchromosome [GenBank: NC_019551] [Browse all T6SS(s) in this replicon]
Location [Strand]1114288..1114782 [-]
Producthypothetical protein
NoteVgrG
UniProt IDK0EB82
KEGG IDfti:FTS_1138, fti:FTS_0110
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|422938863|ref|YP_007012010.1| hypothetical protein FTS_1138 [Francisella tularensis subsp. holarctica FSC200]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
 
Nucleotide Sequence: 495 bp     [Download]
>gi|422937995|ref|NC_019551.1|:c1114782-1114288 Francisella tularensis subsp. holarctica FSC200 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCTACAGCAACAATGGTTG
GATAA