SecReT6
Protein ID: 71733302
SecReT6 ID55
T6SS typei4b
Gene symbol-
Locus tagPSPPH_0118
StrainPseudomonas syringae pv. phaseolicola 1448A
Repliconchromosome [GenBank: NC_005773] [Browse all T6SS(s) in this replicon]
Location [Strand]136114..136368 [-]
Producthypothetical protein
NotePAAR
UniProt IDQ48Q87
KEGG IDpsp:PSPPH_0118
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 2.10E-22, Aligned region: 6..76
DUF4150 [PF13665], Evalue: 0.0023, Aligned region: 11..38
DUF4150 [PF13665], Evalue: 0.0023, Aligned region: 45..67
Protein Sequence: 84 a.a.     [Download]
>gi|71733302|ref|YP_272429.1| unnamed protein product [Pseudomonas syringae pv. phaseolicola 1448A]
MRPIIVINDPTSDAGQVLEGSPSTFINGLAVARVGDRVSCPHGIGTIVSGDETLLVDGRPVAREGDFISC
GARLMATQQDTVDL
 
Nucleotide Sequence: 255 bp     [Download]
>gi|71733195|ref|NC_005773.3|:c136368-136114 Pseudomonas syringae pv. phaseolicola 1448A chromosome, complete genome
ATGCGCCCAATTATCGTTATCAACGATCCTACCTCCGATGCAGGTCAGGTCCTTGAAGGATCGCCCAGCA
CGTTCATAAACGGTTTGGCCGTGGCAAGGGTCGGAGACCGAGTGTCCTGCCCGCATGGCATCGGGACCAT
CGTAAGCGGAGATGAAACCCTGCTGGTGGATGGTCGCCCGGTTGCTCGGGAAGGTGATTTTATCTCCTGT
GGTGCGCGGCTGATGGCAACGCAGCAGGATACCGTGGACCTCTAA