SecReT6
Protein ID: 71907812
SecReT6 ID87
T6SS typei4b
Gene symbol-
Locus tagDaro_2190
StrainDechloromonas aromatica RCB
Repliconchromosome [GenBank: NC_007298] [Browse all T6SS(s) in this replicon]
Location [Strand]2367853..2368119 [-]
ProductPAAR
NotePAAR
UniProt IDQ47E02
KEGG IDdar:Daro_2190
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 7.00E-26, Aligned region: 8..82
DUF4150 [PF13665], Evalue: 0.0096, Aligned region: 19..40
DUF4150 [PF13665], Evalue: 0.0096, Aligned region: 48..74
Protein Sequence: 88 a.a.     [Download]
>gi|71907812|ref|YP_285399.1| PAAR [Dechloromonas aromatica RCB]
MSRPFILLGDKTDHGGVVITASESSDCNGKGVARVGDQVTCPKRGHGNVTTIVTGDSTALIDGRPAARHG
DKTACGAILIASQSLTTD
 
Nucleotide Sequence: 267 bp     [Download]
>gi|71905642|ref|NC_007298.1|:c2368119-2367853 Dechloromonas aromatica RCB, complete genome
ATGAGCAGACCTTTCATTCTATTGGGCGACAAGACGGATCACGGCGGGGTGGTAATCACCGCATCCGAAT
CGAGCGACTGCAACGGAAAGGGCGTGGCCCGGGTTGGTGATCAGGTGACCTGCCCGAAGCGTGGTCATGG
CAACGTAACGACCATTGTTACCGGAGATTCCACGGCGCTGATTGATGGACGCCCGGCGGCTCGTCATGGG
GACAAAACTGCTTGTGGTGCGATATTGATCGCCAGCCAATCGTTGACAACTGATTAA