SecReT6
Protein ID: 77465481
SecReT6 ID99
T6SS typei3
Gene symbol-
Locus tagRSP_3480
StrainRhodobacter sphaeroides 2.4.1
Repliconchromosome II [GenBank: NC_007494] [Browse all T6SS(s) in this replicon]
Location [Strand]550086..550793 [+]
Producthypothetical protein
NoteTssE
UniProt IDQ3IWK1
KEGG IDrsp:RSP_3480
PDB IDNA
Domain hit(s) vs Pfam GPW_gp25 [PF04965], Evalue: 2.40E-26, Aligned region: 92..215
Protein Sequence: 235 a.a.     [Download]
>gi|77465481|ref|YP_354984.1| unnamed protein product [Rhodobacter sphaeroides 2.4.1]
MPETVIPPHARREAVQPSLWDRLREDLPGLIAESGRARAALARELGEERLDELLARGRAGLTGLDEGQRR
AVLRLMALLDRRAFLEEHGLLVTPEALREAVRRDVEALFNTERLQAHLLLGAAERGAAEDPADTLEDFPH
VRRSVLNFGVPAFSGRRARDFDPERLARDLREVVALFEPRLRRDTLRIRVDTHDRSGLRISIEGVLMLAP
VPERLRLSTMLDLDTGSASTALEEA
 
Nucleotide Sequence: 708 bp     [Download]
>gi|77464988|ref|NC_007494.1|:550086-550793 Rhodobacter sphaeroides 2.4.1 chromosome 2, complete sequence
ATGCCCGAGACGGTGATACCCCCTCATGCCCGCCGCGAGGCGGTGCAGCCGAGCCTCTGGGACCGGCTGC
GCGAGGATCTGCCCGGCCTCATCGCCGAAAGCGGGCGGGCCCGGGCGGCCCTCGCGCGCGAACTGGGCGA
GGAGCGGCTGGACGAGCTGCTCGCCCGGGGGCGGGCTGGGCTGACCGGTCTCGACGAAGGGCAGCGGCGC
GCCGTCCTGCGGCTGATGGCGCTGCTCGACCGGCGCGCGTTTCTCGAGGAGCACGGTCTTCTCGTGACCC
CCGAGGCGCTGCGCGAGGCCGTCCGGCGCGATGTCGAGGCGCTCTTCAACACCGAGCGGCTGCAGGCCCA
TCTTCTGCTCGGCGCAGCCGAGCGCGGGGCGGCGGAAGACCCCGCCGATACTCTCGAAGACTTCCCCCAT
GTCCGGCGCAGCGTGCTGAACTTCGGCGTTCCCGCCTTTTCGGGCCGGCGCGCGCGCGACTTCGATCCCG
AGCGGCTGGCGCGCGATCTGCGCGAGGTGGTGGCTTTGTTCGAGCCGCGGCTGCGGCGCGACACGCTCAG
GATCCGCGTGGACACCCACGACCGCAGCGGCCTGCGCATCTCCATCGAGGGGGTGCTGATGCTCGCCCCC
GTACCCGAGCGGTTGCGGCTGTCAACCATGCTCGACCTCGATACCGGCAGCGCCTCGACCGCGCTCGAGG
AGGCGTGA