SecReT6
Effector Protein ID: 118497892
-
SecReT6 ID158
T6SS typeB
Gene symbol-
Locus tagFTN_1312
StrainFrancisella novicida U112
Repliconchromosome [GenBank: NC_008601] [Browse all T6SS(s) in this replicon]
Location [Strand]1384422..1384916 [+]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTN_1312 (VgrG)
DescriptionVgrG; required for F. tularensis phagosomal escape, intramacrophage growth, virulence, and induction of IL1-beta expression by infected macrophages
UniProt IDQ7X3I8, A0Q7H3
KEGG IDftn:FTN_1312
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0077, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0077, Aligned region: 72..110
DUF2345 [PF10106], Evalue: 0.0077, Aligned region: 107..147
Protein Sequence: 164 a.a.     [Download]
>gi|118497892|ref|YP_898942.1| hypothetical protein FTN_1312 [Francisella novicida U112]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSAATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|118496615|ref|NC_008601.1|:1384422-1384916 Francisella novicida U112 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATTACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTTAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCGCAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGATTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCCGCAGCAACAATGGTTG
GATAA

Reference
(1) Dai S et al. (2011). The acid phosphatase AcpA is secreted in vitro and in macrophages by Francisella spp. Infect Immun . 80(3):1088-97. [PudMed:22184418] experimental
(2) Broms JE et al. (2011). IglG and IglI of the Francisella pathogenicity island are important virulence determinants of Francisella tularensis LVS. Infect Immun. 79(9):3683-96. [PudMed:21690239] experimental
 
experimental experimental literature