SecReT6
Effector Protein ID: 134301206
-
SecReT6 ID472
T6SS typeB
Gene symbol-
Locus tagFTW_0050
StrainFrancisella tularensis subsp. tularensis WY96-3418
Repliconchromosome [GenBank: NC_009257] [Browse all T6SS(s) in this replicon]
Location [Strand]48868..49362 [-]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTT_1347
DescriptionVgrG
UniProt IDA4IVV2
KEGG IDftw:FTW_0547, ftw:FTW_0050
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0078, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0078, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0078, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|134301206|ref|YP_001121174.1| hypothetical protein FTW_0050 [Francisella tularensis subsp. tularensis WY96-3418]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKIKHYATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|134301169|ref|NC_009257.1|:c49362-48868 Francisella tularensis subsp. tularensis WY96-3418 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCAAGCATTATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGCATAAAAGGTTCTACAGCAACAATGGTTG
GATAA