SecReT6
Effector Protein ID: 156501500
-
SecReT6 ID474
T6SS typeB
Gene symbol-
Locus tagFTA_0131
StrainFrancisella tularensis subsp. holarctica FTNF002-00
Repliconchromosome [GenBank: NC_009749] [Browse all T6SS(s) in this replicon]
Location [Strand]117414..117908 [-]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTT_1347
DescriptionVgrG
UniProt IDA7N9F6
KEGG IDfta:FTA_0131
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|156501500|ref|YP_001427565.1| hypothetical protein FTA_0131 [Francisella tularensis subsp. holarctica FTNF002-00]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|156501369|ref|NC_009749.1|:c117908-117414 Francisella tularensis subsp. holarctica FTNF002-00 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCTACAGCAACAATGGTTG
GATAA