SecReT6
Effector Protein ID: 167627600
-
SecReT6 ID476
T6SS typeB
Gene symbol-
Locus tagFphi_1374
StrainFrancisella philomiragia subsp. philomiragia ATCC 25017
Repliconchromosome [GenBank: NC_010336] [Browse all T6SS(s) in this replicon]
Location [Strand]1500593..1501087 [-]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTN_1312
DescriptionVgrG
UniProt IDB0TYC3
KEGG IDfph:Fphi_1374
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 34..87
DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 93..121
DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 107..161
Protein Sequence: 164 a.a.     [Download]
>gi|167627600|ref|YP_001678100.1| hypothetical protein Fphi_1374 [Francisella philomiragia subsp. philomiragia ATCC 25017]
MSKADHIFNLEEQGLLIDIKDESKGCTTKLESSGKISHNATESIESTAEKQITENVKDSKISITEKEILL
ATKKSSIMLNDSKIVIKIGNSTIVLDDSSISIESGTINIKSSANTNIQASQNIGIKGLNNSIKADVSLNA
EGVNVNIKGSATASIKGSAATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>ref|NC_010336.1|:c1501087-1500593 hypothetical protein Fphi_1374 [Francisella philomiragia subsp. philomiragia ATCC 25017]
ATGTCAAAAGCAGACCATATTTTTAACCTAGAAGAACAAGGTTTACTCATAGATATAAAAGATGAGTCAA
AAGGCTGTACTACTAAATTAGAATCCTCAGGAAAAATTTCTCATAACGCGACAGAATCTATAGAGTCAAC
AGCTGAAAAACAAATAACTGAAAATGTCAAAGATTCAAAAATTTCTATAACTGAAAAAGAAATATTATTG
GCTACTAAAAAATCAAGTATTATGCTCAACGATAGTAAAATCGTGATCAAAATAGGTAACTCGACTATTG
TGCTTGATGACTCAAGTATTTCTATAGAGTCTGGAACTATTAATATAAAAAGCTCTGCTAATACAAATAT
CCAAGCATCACAAAATATTGGAATAAAAGGCCTAAACAATAGTATAAAAGCCGATGTAAGTCTGAATGCT
GAAGGTGTAAACGTAAACATCAAAGGAAGTGCAACAGCAAGCATAAAAGGATCTGCAGCAACAATGGTGG
GATAA