SecReT6
Effector Protein ID: 187931781
-
SecReT6 ID477
T6SS typeB
Gene symbol-
Locus tagFTM_1089
StrainFrancisella tularensis subsp. mediasiatica FSC147
Repliconchromosome [GenBank: NC_010677] [Browse all T6SS(s) in this replicon]
Location [Strand]1167438..1167932 [+]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTT_1347
DescriptionVgrG
UniProt IDB2SEB8
KEGG IDftm:FTM_1089, ftm:FTM_1699
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|187931781|ref|YP_001891766.1| hypothetical protein FTM_1089 [Francisella tularensis subsp. mediasiatica FSC147]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|187930913|ref|NC_010677.1|:1167438-1167932 Francisella tularensis subsp. mediasiatica FSC147 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGCATAAAAGGTTCTACAGCAACAATGGTTG
GATAA