SecReT6
Effector Protein ID: 337755029
-
SecReT6 ID479
T6SS typeB
Gene symbol-
Locus tagF7308_1013
StrainFrancisella sp. TX077308
Repliconchromosome [GenBank: NC_015696] [Browse all T6SS(s) in this replicon]
Location [Strand]1041330..1041824 [-]
ProductvgrG protein
Effector typeProtein
Homologous effectorFTN_1312
DescriptionVgrG
UniProt IDF8GC23
KEGG IDfrt:F7308_1013
PDB IDNA
Domain hit(s) vs Pfam NA
Protein Sequence: 164 a.a.     [Download]
>gi|337755029|ref|YP_004647540.1| vgrG protein [Francisella sp. TX077308]
MSKADHIFNLEEQGLLIDIKDESKGCTTKLESSGKISHNATESIESTADKQIIDNVKDSKISITEKEILL
ATKKSSIMLNDSKIVLKIGNSTIVLDDSSISIESGTINVKSSANTNIQAAQNIGIKGLNNSIKADVSLNA
EGVNVNIKGSATASIKGSAATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|337754017|ref|NC_015696.1|:c1041824-1041330 Francisella sp. TX077308 chromosome, complete genome
ATGTCAAAAGCAGATCATATTTTTAATTTAGAAGAACAGGGTTTACTCATAGACATAAAAGATGAGTCAA
AAGGCTGTACTACTAAGTTAGAATCCTCAGGAAAAATCTCTCATAACGCAACTGAATCAATTGAATCAAC
TGCTGACAAGCAAATAATCGACAATGTAAAAGACTCAAAAATTTCAATAACGGAAAAAGAAATATTATTA
GCTACGAAAAAATCAAGCATCATGCTTAATGATAGCAAAATTGTGCTAAAAATAGGTAATTCGACTATTG
TGCTTGATGACTCGAGTATTTCTATAGAGTCAGGAACAATTAATGTAAAAAGCTCTGCAAACACAAATAT
TCAAGCTGCACAGAACATCGGCATAAAAGGCTTAAATAATAGTATAAAAGCTGATGTAAGCCTTAATGCA
GAAGGTGTAAATGTCAATATCAAAGGAAGTGCTACAGCAAGTATAAAAGGTTCTGCAGCAACAATGGTTG
GTTAA