SecReT6
Effector Protein ID: 385793282
-
SecReT6 ID774
T6SS typeB
Gene symbol-
Locus tagFNFX1_1350
StrainFrancisella cf. novicida Fx1
Repliconchromosome [GenBank: NC_017450] [Browse all T6SS(s) in this replicon]
Location [Strand]1383866..1384360 [+]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTN_1312
DescriptionVgrG
UniProt IDF4BCN4
KEGG IDfcf:FNFX1_1350
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0077, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0077, Aligned region: 72..110
DUF2345 [PF10106], Evalue: 0.0077, Aligned region: 107..147
Protein Sequence: 164 a.a.     [Download]
>gi|385793282|ref|YP_005826258.1| hypothetical protein [Francisella cf. novicida Fx1]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSAATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|385791932|ref|NC_017450.1|:1383866-1384360 Francisella cf. novicida Fx1 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTTAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATCGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCTGCAGCAACCATGGTTG
GATAA