SecReT6
Effector Protein ID: 385795488
-
SecReT6 ID776
T6SS typeB
Gene symbol-
Locus tagNE061598_09900
StrainFrancisella tularensis subsp. tularensis NE061598
Repliconchromosome [GenBank: NC_017453] [Browse all T6SS(s) in this replicon]
Location [Strand]1779320..1779814 [+]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTT_1347
DescriptionVgrG
UniProt IDD2AK95
KEGG IDftr:NE061598_09900, ftr:NE061598_07460
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|385795488|ref|YP_005831894.1| hypothetical protein NE061598_09900 [Francisella tularensis subsp. tularensis NE061598]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|385793751|ref|NC_017453.1|:1779320-1779814 Francisella tularensis subsp. tularensis NE061598 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGCATAAAAGGTTCTACAGCAACAATGGTTG
GATAA