SecReT6
Effector Protein ID: 387824959
-
SecReT6 ID773
T6SS typeB
Gene symbol-
Locus tagFN3523_1376
StrainFrancisella cf. novicida 3523
Repliconchromosome [GenBank: NC_017449] [Browse all T6SS(s) in this replicon]
Location [Strand]1411622..1412116 [+]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTN_1312
DescriptionVgrG
UniProt IDF4BGT5
KEGG IDfcn:FN3523_1376
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0085, Aligned region: 34..87
DUF2345 [PF10106], Evalue: 0.0085, Aligned region: 95..121
DUF2345 [PF10106], Evalue: 0.0085, Aligned region: 106..162
Protein Sequence: 164 a.a.     [Download]
>gi|387824959|ref|YP_005824430.1| hypothetical protein FN3523_1376 [Francisella cf. novicida 3523]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESTADKQIIENVKDSKISITEKEILL
ATKKSSIMLNDNKIIIKIGSSSIVLDDSSISLESATINIKSSANINIQASQNIDIKGLNNSIKADINLNA
EGTDVNIKGSVTASIKGSAVTMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|387823583|ref|NC_017449.1|:1411622-1412116 Francisella cf. novicida 3523 chromosome, complete genome
ATGTCAAAAGCAGATCATATTTTCAACTTAGAAGAGCAAGGATTACTAATAGATATCAAAGATGATTCAA
AAGGATGTACTACTAAACTAGAGTCTTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAC
AGCTGATAAACAAATAATTGAAAATGTTAAAGACTCAAAGATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACCAAGAAGTCAAGCATTATGCTTAATGATAATAAAATTATTATCAAAATAGGGAGTTCATCTATTG
TCCTTGATGATTCAAGTATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAAAATATTGATATCAAAGGTCTAAATAATAGTATCAAAGCAGATATAAATCTTAATGCT
GAAGGTACAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCTGCAGTAACAATGGTTG
GATAA