SecReT6
Effector Protein ID: 387886583
-
SecReT6 ID777
T6SS typeB
Gene symbol-
Locus tagOOM_0941
StrainFrancisella noatunensis subsp. orientalis str. Toba 04
Repliconchromosome [GenBank: NC_017909] [Browse all T6SS(s) in this replicon]
Location [Strand]938115..938609 [-]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTN_1312
DescriptionVgrG
UniProt IDI2AZ09
KEGG IDfna:OOM_0941
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 34..87
DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 93..121
DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 107..161
Protein Sequence: 164 a.a.     [Download]
>gi|387886583|ref|YP_006316882.1| hypothetical protein OOM_0941 [Francisella noatunensis subsp. orientalis str. Toba 04]
MSKADHIFNLEEQGLLIDIKDESKGCTTKLESSGKISHNATESIESTAEKQITENVKDSKISITEKEILL
ATKKSSIMLNDSKIVIKIGNSTIVLDDSSISIESGTINIKSSANTNIQASQNIGIKGLNNSIKADVSLNA
EGVNVNIKGSATASIKGSAATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|387885754|ref|NC_017909.1|:c938609-938115 Francisella noatunensis subsp. orientalis str. Toba 04 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTTAACCTAGAAGAACAAGGTTTACTTATAGATATAAAAGATGAGTCAA
AAGGCTGTACTACTAAATTAGAATCCTCAGGAAAAATTTCTCATAATGCGACAGAATCTATAGAGTCAAC
AGCTGAAAAACAAATAACTGAAAATGTCAAAGATTCAAAAATTTCTATAACTGAAAAAGAAATATTATTG
GCTACTAAAAAATCAAGTATTATGCTCAACGATAGTAAAATCGTGATCAAAATAGGTAACTCGACTATTG
TGCTTGATGACTCAAGTATTTCTATAGAGTCTGGAACTATTAATATAAAAAGCTCTGCTAATACAAATAT
CCAAGCATCACAAAATATTGGAATAAAAGGTCTAAACAATAGTATAAAAGCCGATGTGAGCCTGAATGCT
GAAGGTGTAAACGTAAACATCAAAGGAAGTGCAACAGCAAGCATAAAAGGATCAGCAGCAACAATGGTGG
GATAA