SecReT6
Effector Protein ID: 422938075
-
SecReT6 ID780
T6SS typeB
Gene symbol-
Locus tagFTS_0110
StrainFrancisella tularensis subsp. holarctica FSC200
Repliconchromosome [GenBank: NC_019551] [Browse all T6SS(s) in this replicon]
Location [Strand]117678..118172 [-]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTT_1347
DescriptionVgrG
UniProt IDK0EB82
KEGG IDfti:FTS_1138, fti:FTS_0110
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|422938075|ref|YP_007011222.1| hypothetical protein FTS_0110 [Francisella tularensis subsp. holarctica FSC200]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|422937995|ref|NC_019551.1|:c118172-117678 Francisella tularensis subsp. holarctica FSC200 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCTACAGCAACAATGGTTG
GATAA