SecReT6
Effector Protein ID: 423049864
-
SecReT6 ID778
T6SS typeB
Gene symbol-
Locus tagF92_00675
StrainFrancisella tularensis subsp. holarctica F92
Repliconchromosome [GenBank: NC_019537] [Browse all T6SS(s) in this replicon]
Location [Strand]117407..117901 [-]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTT_1347
DescriptionVgrG
UniProt IDK7WY33
KEGG IDfts:F92_00675, fts:F92_06455
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|423049864|ref|YP_007008298.1| hypothetical protein F92_00675 [Francisella tularensis subsp. holarctica F92]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|423049750|ref|NC_019537.1|:c117901-117407 Francisella tularensis subsp. holarctica F92 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCTACAGCAACAATGGTTG
GATAA