SecReT6
Effector Protein ID: 565642694
-
SecReT6 ID882
T6SS typeB
Gene symbol-
Locus tagM973_07565
StrainFrancisella noatunensis subsp. orientalis LADL--07-285A
Repliconchromosome [GenBank: NC_023029] [Browse all T6SS(s) in this replicon]
Location [Strand]1364880..1365374 [+]
ProductvgrG protein
Effector typeProtein
Homologous effectorFTN_1312
DescriptionVgrG
UniProt IDV5VZ62
KEGG IDNA
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 34..87
DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 93..121
DUF2345 [PF10106], Evalue: 0.0089, Aligned region: 107..161
Protein Sequence: 164 a.a.     [Download]
>gi|565642694|ref|YP_008893540.1| vgrG protein [Francisella noatunensis subsp. orientalis LADL--07-285A]
MSKADHIFNLEEQGLLIDIKDESKGCTTKLESSGKISHNATESIESTAEKQITENVKDSKISITEKEILL
ATKKSSIMLNDSKIVIKIGNSTIVLDDSSISIESGTINIKSSANTNIQASQNIGIKGLNNSIKADVSLNA
EGVNVNIKGSATASIKGSAATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|565641727|ref|NC_023029.1|:1364880-1365374 Francisella noatunensis subsp. orientalis LADL--07-285A, complete genome
ATGTCAAAAGCAGACCATATTTTTAACCTAGAAGAACAAGGTTTACTTATAGATATAAAAGATGAGTCAA
AAGGCTGTACTACTAAATTAGAATCCTCAGGAAAAATTTCTCATAATGCGACAGAATCTATAGAGTCAAC
AGCTGAAAAACAAATAACTGAAAATGTCAAAGATTCAAAAATTTCTATAACTGAAAAAGAAATATTATTG
GCTACTAAAAAATCAAGTATTATGCTCAACGATAGTAAAATCGTGATCAAAATAGGTAACTCGACTATTG
TGCTTGATGACTCAAGTATTTCTATAGAGTCTGGAACTATTAATATAAAAAGCTCTGCTAATACAAATAT
CCAAGCATCACAAAATATTGGAATAAAAGGTCTAAACAATAGTATAAAAGCCGATGTGAGCCTGAATGCT
GAAGGTGTAAACGTAAACATCAAAGGAAGTGCAACAGCAAGCATAAAAGGATCAGCAGCAACAATGGTGG
GATAA