SecReT6
Effector Protein ID: 56708403
-
SecReT6 ID81
T6SS typeB
Gene symbol-
Locus tagFTT_1347
StrainFrancisella tularensis subsp. tularensis SCHU S4
Repliconchromosome [GenBank: NC_006570] [Browse all T6SS(s) in this replicon]
Location [Strand]1386053..1386547 [+]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTT_1347 (VgrG)
DescriptionVgrG
UniProt IDQ5NED5
KEGG IDftu:FTT_1347, ftu:FTT_1702
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|56708403|ref|YP_170299.1| unnamed protein product [Francisella tularensis subsp. tularensis SCHU S4]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|255961454|ref|NC_006570.2|:1386053-1386547 Francisella tularensis subsp. tularensis SCHU S4 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGCATAAAAGGTTCTACAGCAACAATGGTTG
GATAA

Reference
(1) Dai S et al. (2011). The acid phosphatase AcpA is secreted in vitro and in macrophages by Francisella spp. Infect Immun . 80(3):1088-97. [PudMed:22184418] experimental
(2) Broms JE et al. (2011). IglG and IglI of the Francisella pathogenicity island are important virulence determinants of Francisella tularensis LVS. Infect Immun. 79(9):3683-96. [PudMed:21690239] experimental
 
experimental experimental literature