SecReT6
Effector Protein ID: 89256491
-
SecReT6 ID467
T6SS typeB
Gene symbol-
Locus tagFTL_1169
StrainFrancisella tularensis subsp. holarctica LVS
Repliconchromosome [GenBank: NC_007880] [Browse all T6SS(s) in this replicon]
Location [Strand]1112317..1112811 [-]
Producthypothetical protein
Effector typeProtein
Homologous effectorFTT_1347 (VgrG)
DescriptionVgrG
UniProt IDQ2A349
KEGG IDftl:FTL_0123, ftl:FTL_1169
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|89256491|ref|YP_513853.1| hypothetical protein FTL_1169 [Francisella tularensis subsp. holarctica LVS]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
-
Nucleotide Sequence: 495 bp     [Download]
>gi|89255449|ref|NC_007880.1|:c1112811-1112317 Francisella tularensis subsp. holarctica LVS chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCTACAGCAACAATGGTTG
GATAA

Reference
(1) Broms JE et al. (2011). IglG and IglI of the Francisella pathogenicity island are important virulence determinants of Francisella tularensis LVS. Infect Immun. 79(9):3683-96. [PudMed:21690239] experimental
 
experimental experimental literature